pGEMHE-miRFP-MAP4-MTBD
(Plasmid
#171487)
-
PurposeT7 promotor drives in vitro transcription of miRFP-tagged mouse MAP4-Microtubule Binding Domain mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEHME
-
Vector typepGEHME
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAP4-MTBD
-
SpeciesM. musculus (mouse)
-
MutationAminoacids 658-1126
-
Entrez GeneMap4 (a.k.a. AA407148, MAP-4, Mtap-4, Mtap4)
- Promoter T7
-
Tag
/ Fusion Protein
- miRFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer M13: GTAAAACGACGGCCAGT
- 3′ sequencing primer GGCTACATTTTGGGGGACAACATTTTGTAAAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is the Microtubule binding domain of MAP4.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-miRFP-MAP4-MTBD was a gift from Melina Schuh (Addgene plasmid # 171487 ; http://n2t.net/addgene:171487 ; RRID:Addgene_171487) -
For your References section:
Parental genome unification is highly error-prone in mammalian embryos. Cavazza T, Takeda Y, Politi AZ, Aushev M, Aldag P, Baker C, Choudhary M, Bucevicius J, Lukinavicius G, Elder K, Blayney M, Lucas-Hahn A, Niemann H, Herbert M, Schuh M. Cell. 2021 Apr 30. pii: S0092-8674(21)00492-X. doi: 10.1016/j.cell.2021.04.013. 10.1016/j.cell.2021.04.013 PubMed 33964210