Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti HsATP13A2 WT
(Plasmid #171485)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171485 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiviral transferplasmid
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 11367
  • Total vector size (bp) 14913
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human ATP13A2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3528
  • Mutation
    D508N , D962N
  • GenBank ID
    NP_001135445
  • Entrez Gene
    ATP13A2 (a.k.a. CLN12, HSA9947, KRPPD, PARK9, SPG78)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BcuI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti HsATP13A2 WT was a gift from Veerle Baekelandt (Addgene plasmid # 171485 ; http://n2t.net/addgene:171485 ; RRID:Addgene_171485)
  • For your References section:

    ATP13A2 deficiency disrupts lysosomal polyamine export. van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, Kahler JP, Decuypere JP, Gelders G, Lambie E, Zielich J, Swinnen JV, Annaert W, Agostinis P, Ghesquiere B, Verhelst S, Baekelandt V, Eggermont J, Vangheluwe P. Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29. 10.1038/s41586-020-1968-7 PubMed 31996848