Skip to main content
Addgene

sgLacZs
(Plasmid #171185)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-hU6-gRNA-hSyn-mCherry-KASH
  • Backbone size w/o insert (bp) 5294
  • Total vector size (bp) 5657
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hU6-sgLacZ1-hU6-sgLacZ2
  • Alt name
    sgLacZs
  • gRNA/shRNA sequence
    GTGTTCGCATTATCCGAACCAT, GCGCGATCGTAATCACCCGAGT
  • Species
    M. musculus (mouse)
  • Promoter U6, hSyn
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer ITR_R CGGCCTCAGTGAGCGA
  • 3′ sequencing primer hSyn_R gtcggtcgtcaggtaggcac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note Addgene NGS identified two mutations in mCherry (K14E, N210D) and one in KASH domain of Nesprin2 E>G. Depositor confirms plasmid is functional.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgLacZs was a gift from Han Kyoung Choe (Addgene plasmid # 171185 ; http://n2t.net/addgene:171185 ; RRID:Addgene_171185)
  • For your References section:

    Multiplexed CRISPR-Cas9 system in a single adeno-associated virus to simultaneously knock out redundant clock genes. Kim B, Kim J, Chun M, Park I, Kwak D, Choi M, Kim K, Choe HK. Sci Rep. 2021 Jan 28;11(1):2575. doi: 10.1038/s41598-021-82287-0. 10.1038/s41598-021-82287-0 PubMed 33510438