pLI_C-tag TNF linker mCherry
(Plasmid #171181)

• Purpose: inducible expression of mCherry fused to C-tag TNF
• Depositing Lab: Veit Hornung
• Publication: Pinci et al J Biol Chem. 2020 Dec 25;295(52):18065-18075. doi: 10.1074/jbc.RA120.015248. Epub 2020 Oct 20.

Backbone

• Vector backbone: pLIX_403
• Backbone manufacturer: David Root
• Backbone size w/o insert (bp): 6947
• Total vector size (bp): 8369
• Modifications to backbone: Puromycin resistance was removed
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C-tag TNF linker mCherry
• Species: H. sapiens (human)
• Insert Size (bp): 1422
• GenBank ID: NM_000594.4
• Promoter: tight TRE promoter
• Tags / Fusion Proteins:
  • mCherry (N terminal on insert)
  • C-tag (internal)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GTATGTCGAGGTAGGCGTGTACG
• 3′ sequencing primer: CTGCGTTTCCCGGAACCA

Resource Information

• Supplemental Documents:
  • pLI_C-tag TNF linker mCherry.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry