Skip to main content
Addgene

pLI_C-tag TNF
(Plasmid #171178)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171178 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLIX_403
  • Backbone manufacturer
    David Root
  • Backbone size w/o insert (bp) 7607
  • Total vector size (bp) 8309
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C-tag TNF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    702
  • Mutation
    ADAM cleavage site of TNF (AA73-76) was exchanged for the C-tag sequence
  • Promoter tight TRE promoter
  • Tag / Fusion Protein
    • C-tag (internal)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GTATGTCGAGGTAGGCGTGTACG
  • 3′ sequencing primer CTGCGTTTCCCGGAACCA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLI_C-tag TNF was a gift from Veit Hornung (Addgene plasmid # 171178 ; http://n2t.net/addgene:171178 ; RRID:Addgene_171178)

  • For your References section:

    C-tag TNF: a reporter system to study TNF shedding. Pinci F, Gaidt MM, Jung C, Kuut G, Jackson MA, Bauernfried S, Hornung V. J Biol Chem. 2020 Dec 25;295(52):18065-18075. doi: 10.1074/jbc.RA120.015248. Epub 2020 Oct 20. 10.1074/jbc.RA120.015248 PubMed 33082141
Related items: