pYAL_HLA-A2_MART1
(Plasmid
#171177)
-
PurposeDisplays MART-1 peptide in HLA-A*02 as a single-chain trimer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepYAL
-
Vector typeBacterial Expression, Yeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMART1_HLA-A2*01 single-chain trimer fusion
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1290
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gaagactctcctccgtgcgt
- 3′ sequencing primer CGTAAGCATATTGGTGATAACCTCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYAL_HLA-A2_MART1 was a gift from Michael Birnbaum (Addgene plasmid # 171177 ; http://n2t.net/addgene:171177 ; RRID:Addgene_171177) -
For your References section:
Yeast Display for the Identification of Peptide-MHC Ligands of Immune Receptors. Huisman BD, Grace BE, Holec PV, Birnbaum ME. Methods Mol Biol. 2022;2491:263-291. doi: 10.1007/978-1-0716-2285-8_15. 10.1007/978-1-0716-2285-8_15 PubMed 35482196