Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYAL_HLA-A2_MART1
(Plasmid #171177)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171177 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pYAL
  • Vector type
    Bacterial Expression, Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MART1_HLA-A2*01 single-chain trimer fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1290
  • Promoter GAL1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gaagactctcctccgtgcgt
  • 3′ sequencing primer CGTAAGCATATTGGTGATAACCTCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYAL_HLA-A2_MART1 was a gift from Michael Birnbaum (Addgene plasmid # 171177 ; http://n2t.net/addgene:171177 ; RRID:Addgene_171177)
  • For your References section:

    Yeast Display for the Identification of Peptide-MHC Ligands of Immune Receptors. Huisman BD, Grace BE, Holec PV, Birnbaum ME. Methods Mol Biol. 2022;2491:263-291. doi: 10.1007/978-1-0716-2285-8_15. 10.1007/978-1-0716-2285-8_15 PubMed 35482196