Skip to main content
Addgene

pWZL-N1ICD-Flag
(Plasmid #171171)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171171 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pWZL
  • Backbone size w/o insert (bp) 5722
  • Total vector size (bp) 8134
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NOTCH1 intracellular domain
  • Alt name
    N1ICD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2394
  • Mutation
    Will express residues 1758-2556 of human NOTCH1, as per Capobianco et al, Mol Cell Biol, 1997
  • GenBank ID
    NM_017617
  • Entrez Gene
    NOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
  • Promoter Viral LTR
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gag1174 TACATCGTGACCTGGGAAGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL-N1ICD-Flag was a gift from Masashi Narita (Addgene plasmid # 171171 ; http://n2t.net/addgene:171171 ; RRID:Addgene_171171)

  • For your References section:

    NOTCH1 mediates a switch between two distinct secretomes during senescence. Hoare M, Ito Y, Kang TW, Weekes MP, Matheson NJ, Patten DA, Shetty S, Parry AJ, Menon S, Salama R, Antrobus R, Tomimatsu K, Howat W, Lehner PJ, Zender L, Narita M. Nat Cell Biol. 2016 Sep;18(9):979-92. doi: 10.1038/ncb3397. Epub 2016 Aug 15. 10.1038/ncb3397 PubMed 27525720
Related items: