pCK255
(Plasmid #171155)

• Purpose: Expression of I-SceI gene for genome engineering in Pseudomonas with sacB gene included for counterselection with sucrose on pBBR1-GmR plasmid
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002.

Backbone

• Vector backbone: pBBR1-MCS5
• Backbone manufacturer: Kenneth M. Peterson
• Backbone size w/o insert (bp): 4768
• Total vector size (bp): 8020
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Medium Copy in P. putida
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: I-SceI_sacB
• Species: Synthetic
• Insert Size (bp): 3256

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggggagaggcggtttgcgta
• 3′ sequencing primer: cgtttgtgatggcttccatg

Resource Information

• Supplemental Documents:
  • pCK255.gbk
• A portion of this plasmid was derived from a plasmid made by: Pablo Ivan Nikel, Herbert Schweizer

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternative names: pBBR1-GmR_I-SceI_sacB