pPPC017.109
(Plasmid
#171145)
-
PurposeExpression of J1-BBa_J23117-mRFP and J109 scRNA on pBBR1-KmR plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBBR1-MCS2
-
Backbone manufacturerKenneth M. Peterson
- Backbone size w/o insert (bp) 5148
- Total vector size (bp) 6639
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium Copy in P. putida
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameJ109 scRNA
-
Alt nameAGGTATCCTGCGGTGTCCTG
-
SpeciesSynthetic
-
Insert Size (bp)525
- Promoter BBa_J23119
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tttcccagtcacgacgttgt
- 3′ sequencing primer tgaccatgattacgccaagc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameJ1-BBa_J23117-mRFP
-
SpeciesSynthetic
-
Insert Size (bp)1073
- Promoter J1-BBa_J23117
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggggagaggcggtttgcgta
- 3′ sequencing primer cgtttgtgatggcttccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative names: pCK058, pBBR1-KmR_J1-mRFP_J109
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPPC017.109 was a gift from Jesse Zalatan (Addgene plasmid # 171145 ; http://n2t.net/addgene:171145 ; RRID:Addgene_171145) -
For your References section:
Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546