Skip to main content
Addgene

pPPC011
(Plasmid #171143)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171143 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pRK2-KmR
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 4577
  • Total vector size (bp) 10215
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Medium Copy in P. putida
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
  • Species
    S. pyogenes (dCas9), MS2 (MCP), E. coli (SoxS)
  • Insert Size (bp)
    5642
  • Mutation
    SoxS has R93A and S101A mutations
  • Promoter Sp.pCas9, BBa_J23107

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggggagaggcggtttgcgta
  • 3′ sequencing primer cgtttgtgatggcttccatg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative names: pCK145, pRK2-KmR_Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPC011 was a gift from Jesse Zalatan (Addgene plasmid # 171143 ; http://n2t.net/addgene:171143 ; RRID:Addgene_171143)

  • For your References section:

    Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546
Related items:
Commonly requested with: