Skip to main content
Addgene

pPPC005
(Plasmid #171140)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171140 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pPPC001
  • Backbone manufacturer
    Jesse Zalatan
  • Backbone size w/o insert (bp) 10153
  • Total vector size (bp) 11726
  • Modifications to backbone
    Replace Sp.pCas9 promoter with XylS-Pm
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also resistant to Ampicillin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    XylS-Pm
  • Species
    P. putida
  • Insert Size (bp)
    2116
  • Promoter Pm

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer accgaacaggcttatgtcaa
  • 3′ sequencing primer CGAGTCGCTTCCGCTGTCTCTCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Pablo Ivan Nikel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative names: pCK193, pUC18TminiTn7T-Gm_XylS-Pm-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate XylS-Pm-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.

Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPPC005 was a gift from Jesse Zalatan (Addgene plasmid # 171140 ; http://n2t.net/addgene:171140 ; RRID:Addgene_171140)

  • For your References section:

    Portable bacterial CRISPR transcriptional activation enables metabolic engineering in Pseudomonas putida. Kiattisewee C, Dong C, Fontana J, Sugianto W, Peralta-Yahya P, Carothers JM, Zalatan JG. Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002. 10.1016/j.ymben.2021.04.002 PubMed 33930546
Related items: