Skip to main content
Addgene

pAAV gfaABC1D NES-jRCaMP1a
(Plasmid #171120)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171120 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5039
  • Total vector size (bp) 6448
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    jRCaMP1a
  • Alt name
    RCaMP1h variant 1488
  • Species
    Synthetic
  • Insert Size (bp)
    1409
  • Promoter gfaABC1D
  • Tag / Fusion Protein
    • His Tag, T7 Tag, XpressTag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGTCGTGAGGCACTGGGCAG
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    jRCaMP1a is from Douglas Kim, GENIE Project Addgene ID #61562 The promotor is from Baljit Khakh Addgene ID #52925,

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV gfaABC1D NES-jRCaMP1a was a gift from Thomas Oertner (Addgene plasmid # 171120 ; http://n2t.net/addgene:171120 ; RRID:Addgene_171120)
  • For your References section:

    Using Genetically Encoded Calcium Indicators to Study Astrocyte Physiology: A Field Guide. Lohr C, Beiersdorfer A, Fischer T, Hirnet D, Rotermund N, Sauer J, Schulz K, Gee CE. Front Cell Neurosci. 2021 Jun 11;15:690147. doi: 10.3389/fncel.2021.690147. eCollection 2021. 10.3389/fncel.2021.690147 PubMed 34177468