pLentiDP1.0
(Plasmid #171094)

• Purpose: lentiviral construct (3rd generation) for the expression of cell cycle-independent OsTIR1 fused with mEmerald and miniAID-fused mCherry2
• Depositing Lab: Dario Palmieri
• Publication: Capece et al Cell Death Differ. 2023 Aug 3. doi: 10.1038/s41418-023-01191-4.

Backbone

• Vector backbone: pLenti CMV Blast DEST (706-1)
• Backbone manufacturer: Eric Campeau, Paul Kaufman
• Modifications to backbone: Gateway sequences removed
• Vector type: Mammalian Expression, Lentiviral, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OsTIR1-mEmerald-P2A-miniAID-mCherry2
• Species: H. sapiens (human), Synthetic
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGTACGGTGGGAGGTCTAT

Resource Information

• Supplemental Documents:
  • pDPLenti 1-0.gb
• A portion of this plasmid was derived from a plasmid made by: pLenti CMV Blast DEST (706-1) was used as backbone (Addgene 17451). MK232 CMV-OsTIR1-PURO (Addgene #7283433) was used as PCR template for OsTIR1; the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234; RRID:Addgene_54234). pDP20 was used as a template for miniAID-mCherry2

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.04.23.441203v1 for bioRxiv preprint.