pDP1.2
(Plasmid #171092)

• Purpose: Expresses cell cycle-dependent OsTIR1 fused with mEmerald and Geminin (1-110). AKA ROLECCS G2(allows integration into AAVS1 safe-harbor)
• Depositing Lab: Dario Palmieri
• Publication: Capece et al Cell Death Differ. 2023 Aug 3. doi: 10.1038/s41418-023-01191-4.

Backbone

• Vector backbone: pMK232 (pBluescript)
• Backbone manufacturer: Masato Kanemaki
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAVS1-CMV-OsTIR1-mEmerald-Geminin-Puro-AAVS1
• Species: H. sapiens (human)
• Promoter: CMV
• Tag / Fusion Protein:
  • Emerald, Geminin

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGTACGGTGGGAGGTCTAT

Resource Information

• Supplemental Documents:
  • pDP1-2.gb
• A portion of this plasmid was derived from a plasmid made by: pMK232 CMV-OsTIR1-PURO (Addgene #72834) was used as backbone plasmid for the expression of OsTIR1 from the AAVS1 locus, the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #92139) was used as template for both hGeminin and hCdt1 tags.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.04.23.441203v1 for bioRxiv preprint.