pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP
(Plasmid
#171090)
-
PurposeCRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus thermophilus (CRISPR1 locus) in Toxoplasma gondii. Suitable for generating stable cell lines.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 8529
-
Vector typeCRISPR ; Toxoplasma gondii expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSth1 dCas9
-
Alt nameStreptococcus thermophilus CRISPR1 dCas9
-
SpeciesStreptococcus thermophilus
-
Insert Size (bp)3363
-
MutationD9A, H599A
- Promoter TUB1 (Toxoplasma gondii)
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- SV40 NLS (N terminal on insert)
- nucleoplasmin NLS (C terminal on insert)
- P2A peptide (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tggtgatcctggttggaccg
- 3′ sequencing primer cgtaacacgccacatcttgc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameChloramphenicol acetyltransferase
-
Alt nameCAT
-
SpeciesShigella flexneri
-
Insert Size (bp)660
- Promoter transcriptionally linked to Sth1 dCas9 via P2A peptide
-
Tag
/ Fusion Protein
- T2A peptide (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cgtaacacgccacatcttgc
- 3′ sequencing primer gtgttcacccttgttacaccg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTagBFP
-
Alt namemonomeric blue fluorescent protein
-
Insert Size (bp)702
- Promoter transcriptionally linked to CAT via T2A peptide
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgttcacccttgttacaccg
- 3′ sequencing primer caatcgttcgcggtgaagag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Sth1 dCas9 insert was cloned from a previously published plasmid, which was kindly provided to us by Jeremy Rock and Sarah Fortune. Rock JM, Hopkins FF, Chavez A, et al. Programmable transcriptional repression in mycobacteria using an orthogonal CRISPR interference platform. Nat Microbiol. 2017;2:16274. Published 2017 Feb 6. doi:10.1038/nmicrobiol.2016.274
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTUB1-Sth.dCas9-P2A-CAT-T2A-TagBFP was a gift from Sebastian Lourido (Addgene plasmid # 171090 ; http://n2t.net/addgene:171090 ; RRID:Addgene_171090) -
For your References section:
CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii. Markus BM, Boydston EA, Lourido S. mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21. 10.1128/mSphere.00474-21 PubMed 34643425