pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy)
(Plasmid
#171089)
-
PurposeCRISPR interference. Construct for expressing catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes in Toxoplasma gondii. Suitable for generating stable cell lines.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171089 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 9826
-
Vector typeCRISPR ; Toxoplasma gondii expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDecoy sgRNA
-
Alt namesgRNA NHE1 3′UTR
-
Alt namesgRNA#1
-
SpeciesSynthetic; Streptococcus pyogenes, Toxoplasma gondii
-
Insert Size (bp)97
- Promoter U6 (Toxoplasma gondii)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ccggccgactctaaataggag
- 3′ sequencing primer gcgggacatgcatggtac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedCas9
-
Alt nameSpy.dCas9
-
Alt nameStreptococcus pyogenes dCas9
-
SpeciesSynthetic; originally from Streptococcus pyogenes, human codon-optimized
-
Insert Size (bp)4101
-
MutationD10A, H840A
- Promoter TUB1 (Toxoplasma gondii)
-
Tags
/ Fusion Proteins
- 3X FLAG (N terminal on backbone)
- Nuclear Localization Signal (N terminal on backbone)
- Nuclear Localization Signal (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer aacccgcgcagaagacatcc
- 3′ sequencing primer aacttcctgtacctggccagc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameChloramphenicol acetyltransferase
-
Alt nameCAT
-
SpeciesShigella flexneri
-
Insert Size (bp)657
- Promoter TUB1 (Toxoplasma gondii)
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site PciI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgtaacacgccacatcttgc
- 3′ sequencing primer gtgttcacccttgttacaccg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was adapted from a construct previously published by Saima Sidik et al. (Addgene plasmid # 80323 ; A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy) was a gift from Sebastian Lourido (Addgene plasmid # 171089 ; http://n2t.net/addgene:171089 ; RRID:Addgene_171089) -
For your References section:
CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii. Markus BM, Boydston EA, Lourido S. mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21. 10.1128/mSphere.00474-21 PubMed 34643425