pQ-Elo-HB-C-A(1-772)
(Plasmid #171085)

• Purpose: Co-expresses of WT-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOB
• Depositing Lab: Joan Conaway
• Publication: He et al Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118.

Backbone

• Vector backbone: pQE-2
• Total vector size (bp): 8511
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Elongin B
• Alt name: TCEB2
• Species: H. sapiens (human)
• Insert Size (bp): 357
• GenBank ID: NM_007108.3
• Entrez Gene: ELOB (a.k.a. SIII, TCEB2)
• Promoter: T5 promoter
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: GGCAACCGAGCGTTCTGAAC

Gene/Insert 2

• Gene/Insert name: Elongin C
• Alt name: TCEB1
• Species: H. sapiens (human)
• Insert Size (bp): 339
• GenBank ID: NM_001204857.1
• Entrez Gene: ELOC (a.k.a. SIII, TCEB1)
• Promoter: T5 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: GGCAACCGAGCGTTCTGAAC

Gene/Insert 3

• Gene/Insert name: Elongin A
• Alt name: TCEB3
• Species: H. sapiens (human)
• Insert Size (bp): 2319
• Mutation: Deleted N-term 26 amino acids for expression purpose
• GenBank ID: A0A024RAC6
• Entrez Gene: ELOA (a.k.a. ELOA1, SIII, SIII p110, TCEB3, TCEB3A)
• Promoter: T5 promoter

Cloning Information for Gene/Insert 3

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: GGCAACCGAGCGTTCTGAAC

Resource Information

• Supplemental Documents:
  • pQ-Elo-BCA-WT.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry