pET-28a (+)-hTFIIB
(Plasmid #171084)

• Purpose: Expresses human TFIIB in bacteria. The resulting plasmid was used to generate a single expression construct encoding a His-tagged TFIIB
• Depositing Lab: Joan Conaway
• Publication: He et al Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118.

Backbone

• Vector backbone: pET-28a
• Backbone size w/o insert (bp): 5272
• Total vector size (bp): 6223
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TF2B
• Species: H. sapiens (human)
• Insert Size (bp): 951
• Entrez Gene: GTF2B (a.k.a. TF2B, TFIIB)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET-28a-hGTF2B.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry