pETDuet-TFIIE
(Plasmid #171083)

• Purpose: Co-expresses human TFIIE. The resulting plasmid was used to generate a single expression construct encoding 2 subunits, with His-tag on TF2E1.Originally from MN Gonzalez, was submitted with permission
• Depositing Lab: Joan Conaway
• Publication: He et al Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118.

Backbone

• Vector backbone: pETDuet-1
• Backbone size w/o insert (bp): 5336
• Total vector size (bp): 7532
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: TF2E1
• Species: H. sapiens (human)
• Insert Size (bp): 1320
• GenBank ID: NM_005513.2
• Entrez Gene: GTF2E1 (a.k.a. FE, TF2E1, TFIIE-A)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: SalI (destroyed during cloning)
• 5′ sequencing primer: ATGCGTCCGGCGTAGA
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: TF2E2
• Species: H. sapiens (human)
• Insert Size (bp): 876
• GenBank ID: NM_002095.5
• Entrez Gene: GTF2E2 (a.k.a. FE, TF2E2, TFIIE-B, TTD6)
• Promoter: T7 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTGTACACGGCCGCATAATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pETDuet-IIE-His-α-N-β.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry