pETDuet-TFIIE
(Plasmid
#171083)
-
PurposeCo-expresses human TFIIE. The resulting plasmid was used to generate a single expression construct encoding 2 subunits, with His-tag on TF2E1.Originally from MN Gonzalez, was submitted with permission
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171083 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETDuet-1
- Backbone size w/o insert (bp) 5336
- Total vector size (bp) 7532
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameTF2E1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1320
-
GenBank IDNM_005513.2
-
Entrez GeneGTF2E1 (a.k.a. FE, TF2E1, TFIIE-A)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site SalI (destroyed during cloning)
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer GATTATGCGGCCGTGTACAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTF2E2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)876
-
GenBank IDNM_002095.5
-
Entrez GeneGTF2E2 (a.k.a. FE, TF2E2, TFIIE-B, TTD6)
- Promoter T7 promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet-TFIIE was a gift from Joan Conaway (Addgene plasmid # 171083 ; http://n2t.net/addgene:171083 ; RRID:Addgene_171083) -
For your References section:
Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872