Skip to main content
Addgene

pETDuet-TFIIF
(Plasmid #171082)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171082 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone size w/o insert (bp) 5348
  • Total vector size (bp) 7652
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    RAP30
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    750
  • GenBank ID
    NM_004128.2
  • Entrez Gene
    GTF2F2 (a.k.a. BTF4, RAP30, TF2F2, TFIIF)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (destroyed during cloning)
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    RAP74
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1554
  • GenBank ID
    NM_002096.2
  • Entrez Gene
    GTF2F1 (a.k.a. BTF4, RAP74, TF2F1, TFIIF)
  • Promoter T7 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETDuet-TFIIF was a gift from Joan Conaway (Addgene plasmid # 171082 ; http://n2t.net/addgene:171082 ; RRID:Addgene_171082)
  • For your References section:

    Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872