Skip to main content
Addgene

pCAT001
(Plasmid #171061)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171061 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4718
  • Total vector size (bp) 7289
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIV-1 Env
  • Insert Size (bp)
    2571
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer TCATGGCAGCCAGCATATGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAT001 was a gift from Jennifer Doudna (Addgene plasmid # 171061 ; http://n2t.net/addgene:171061 ; RRID:Addgene_171061)

  • For your References section:

    Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Hamilton JR, Tsuchida CA, Nguyen DN, Shy BR, McGarrigle ER, Sandoval Espinoza CR, Carr D, Blaeschke F, Marson A, Doudna JA. Cell Rep. 2021 Jun 1;35(9):109207. doi: 10.1016/j.celrep.2021.109207. 10.1016/j.celrep.2021.109207 PubMed 34077734
Related items:
Commonly requested with: