pMSCVhyg-3xT7-nSREBP1a
(Plasmid
#171030)
-
PurposeExpresses 3xT7-tagged nuclear form of SREBP1a in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVhyg-3xT7
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 8200
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenSREBP1a
-
Alt nameSrebf1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1200
-
Mutationamino acids 1- 449
-
Entrez GeneSrebf1 (a.k.a. ADD1, SREBP1, bHLHd1)
- Promoter 5' LTR
-
Tag
/ Fusion Protein
- 3xT7 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVhyg-3xT7-nSREBP1a was a gift from Kai Ge (Addgene plasmid # 171030 ; http://n2t.net/addgene:171030 ; RRID:Addgene_171030) -
For your References section:
MED1 is a lipogenesis coactivator required for postnatal adipose expansion. Jang Y, Park YK, Lee JE, Wan D, Tran N, Gavrilova O, Ge K. Genes Dev. 2021 Apr 22. pii: gad.347583.120. doi: 10.1101/gad.347583.120. 10.1101/gad.347583.120 PubMed 33888555