pAAV-Ef1a-fDIO-ChrimsonR-tdTomato
(Plasmid #171027)

• Purpose: Expresses ChrimsonR-tdTomato fusion after Flp-dependent recombination
• Depositing Lab: Patricia Jensen
• Publication: Sciolino et al Sci Adv. 2022 Aug 19;8(33):eabn9134. doi: 10.1126/sciadv.abn9134. Epub 2022 Aug 19.

Backbone

• Vector backbone: pAAV-Ef1a-fDIO
• Backbone manufacturer: Addgene # 55641
• Backbone size w/o insert (bp): 6323
• Modifications to backbone: EYFP cDNA removed by AscI-NheI double digest
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChrimsonR-tdTomato
• Species: Synthetic
• Insert Size (bp): 2496
• Promoter: Ef1a
• Tag / Fusion Protein:
  • ChrimsonR is fused to tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (destroyed during cloning)
• 5′ sequencing primer: GTTAGGCCAGCTTGGCACTTGATG
• 3′ sequencing primer: CAAAGGCATTAAAGCAGCGTATCC

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-fDIO-ChrimsonR-tdTomato.gb
• A portion of this plasmid was derived from a plasmid made by: ChrimsonR-tdTomato fusion was isolated from Addgene #62723

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Information for AAV1 (Catalog # 171027-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (#171027). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-ChrimsonR-tdTomato plasmid DNA.

Flp-dependent, Ef1a-driven expression of ChrimsonR-tdTomato fusion for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Flp-independent expression.

Information for AAV9 (Catalog # 171027-AAV9)

Purpose

Ready-to-use AAV9 particles produced from pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (#171027). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-ChrimsonR-tdTomato plasmid DNA.

Flp-dependent, Ef1a-driven expression of ChrimsonR-tdTomato fusion for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV9
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Flp-independent expression.