Skip to main content
Addgene

pLPC-dnMAML1-mVenus
(Plasmid #171023)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171023 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLPC
  • Backbone size w/o insert (bp) 5763
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MAML1 Dominant Negative
  • Alt name
    aa12-74 MAML1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    189
  • Mutation
    amino acids 12-74 only, hence conferring dominant negative (DN) properties
  • GenBank ID
    NM_014757
  • Entrez Gene
    MAML1 (a.k.a. Mam-1, Mam1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mVenus (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV ggtgggaggtctatataagc
  • 3′ sequencing primer LTR rev ttgccaaacctacaggtgg
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPC-dnMAML1-mVenus was a gift from Masashi Narita (Addgene plasmid # 171023 ; http://n2t.net/addgene:171023 ; RRID:Addgene_171023)

  • For your References section:

    NOTCH1 mediates a switch between two distinct secretomes during senescence. Hoare M, Ito Y, Kang TW, Weekes MP, Matheson NJ, Patten DA, Shetty S, Parry AJ, Menon S, Salama R, Antrobus R, Tomimatsu K, Howat W, Lehner PJ, Zender L, Narita M. Nat Cell Biol. 2016 Sep;18(9):979-92. doi: 10.1038/ncb3397. Epub 2016 Aug 15. 10.1038/ncb3397 PubMed 27525720
Related items: