Skip to main content
Addgene

pBLlSh2
(Plasmid #170981)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170981 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBBR
  • Backbone size w/o insert (bp) 4787
  • Total vector size (bp) 11777
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    lacI
  • Insert Size (bp)
    1460
  • Promoter pLlac01

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCACGACGTTGTAAAACGA
  • 3′ sequencing primer TGCGCTCTTCCCAGTTC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ShTnsB, ShTnsC, ShTniQ, ShCas12k
  • Species
    Scytonema hofmannii
  • Insert Size (bp)
    5530
  • Promoter pLlac01

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTATGTTGAAAGAGGAGAAAG
  • 3′ sequencing primer gtagagagcgttcaccg
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid #127921 - pHelper_ShCAST_sgRNA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBLlSh2 was a gift from Christopher Reisch (Addgene plasmid # 170981 ; http://n2t.net/addgene:170981 ; RRID:Addgene_170981)

  • For your References section:

    CRISPR-Associated Transposase for Targeted Mutagenesis in Diverse Proteobacteria. Trujillo Rodriguez L, Ellington AJ, Reisch CR, Chevrette MG. ACS Synth Biol. 2023 Jun 27. doi: 10.1021/acssynbio.3c00065. 10.1021/acssynbio.3c00065 PubMed 37368499
Related items: