pX458_sgAgo1_Nterm
(Plasmid
#170921)
-
PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago1 for N-terminal tagging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang Lab (Addgene# 48138)
- Backbone size w/o insert (bp) 9272
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgAgo1
-
gRNA/shRNA sequenceTGGGATGGAAGCGGGACCCT
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneAgo1 (a.k.a. Eif2c, Eif2c1)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer hU6: GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458_sgAgo1_Nterm was a gift from Constance Ciaudo (Addgene plasmid # 170921 ; http://n2t.net/addgene:170921 ; RRID:Addgene_170921) -
For your References section:
AGO1 regulates pericentromeric regions in mouse embryonic stem cells. Muller M, Fah T, Schaefer M, Hermes V, Luitz J, Stalder P, Arora R, Ngondo RP, Ciaudo C. Life Sci Alliance. 2022 Mar 2;5(6). pii: 5/6/e202101277. doi: 10.26508/lsa.202101277. Print 2022 Jun. 10.26508/lsa.202101277 PubMed 35236760