pDGB1a2+pNOS_Red-F_NOSt
(Plasmid
#170887)
-
PurposeGoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Forward orientation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB1_alpha2
-
Backbone manufacturerDiego Orzaez Lab
- Backbone size w/o insert (bp) 2595
-
Vector typePlant Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRed-F
-
Alt nameRed mutant S286Y luciferase from Luciola curciata
-
SpeciesLuciola curciata
-
Insert Size (bp)2443
-
Mutationp.S286Y Red mutant
- Promoter pNOS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGGAAACGCCTGGTATCTTT
- 3′ sequencing primer CCGATCCCCGGAATTAGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Red-F transcriptional unit in GoldenBraid pDGB1 alpha2. Insert can be excised by Esp3I digestion. Requires pSOUP for replication in agrobacterium . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB1a2+pNOS_Red-F_NOSt was a gift from Markita Landry (Addgene plasmid # 170887 ; http://n2t.net/addgene:170887 ; RRID:Addgene_170887) -
For your References section:
A Ratiometric Dual Color Luciferase Reporter for Fast Characterization of Transcriptional Regulatory Elements in Plants. Gonzalez-Grandio E, Demirer GS, Ma W, Brady S, Landry MP. ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248. 10.1021/acssynbio.1c00248 PubMed 34520169