Skip to main content
Addgene

pYI047
(Plasmid #170843)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170843 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pYI001
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pFRO6::SMT2-FLAG
  • Promoter FRO6p

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence.

Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYI047 was a gift from Christian Fankhauser (Addgene plasmid # 170843 ; http://n2t.net/addgene:170843 ; RRID:Addgene_170843)

  • For your References section:

    A combination of plasma membrane sterol biosynthesis and autophagy is required for shade-induced hypocotyl elongation. Ince YC, Krahmer J, Fiorucci AS, Trevisan M, Galvao VC, Wigger L, Pradervand S, Fouillen L, Van Delft P, Genva M, Mongrand S, Gallart-Ayala H, Ivanisevic J, Fankhauser C. Nat Commun. 2022 Oct 10;13(1):5659. doi: 10.1038/s41467-022-33384-9. 10.1038/s41467-022-33384-9 PubMed 36216814
Related items: