AAVS1-Puro CAG eGFP NLS
(Plasmid
#170830)
-
PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1-Puro CAG FUCCI (Addgene #136934)
- Backbone size w/o insert (bp) 10228
- Total vector size (bp) 11738
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)789
- Promoter CAG
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro CAG eGFP NLS was a gift from Xiaoping Bao (Addgene plasmid # 170830 ; http://n2t.net/addgene:170830 ; RRID:Addgene_170830) -
For your References section:
Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy. Chang Y, Syahirah R, Wang X, Jin G, Torregrosa-Allen S, Elzey BD, Hummel SN, Wang T, Li C, Lian X, Deng Q, Broxmeyer HE, Bao X. Cell Rep. 2022 Jul 19;40(3):111128. doi: 10.1016/j.celrep.2022.111128. 10.1016/j.celrep.2022.111128 PubMed 35858579