PiggyBac EF1a-eGFP-Puro U6 ANXA2 g1
(Plasmid
#170826)
-
PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePiggyBac EF1a-eGFP-Puro U6 BbsI
- Backbone size w/o insert (bp) 5575
- Total vector size (bp) 5580
-
Vector typeMammalian Expression ; Piggybac transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas13d ANXA2 gRNA1
-
gRNA/shRNA sequenceCAAACAATTCAGTTGAAAGCAGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)23
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
- 3′ sequencing primer M13 RVS (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g1 was a gift from Xiaoping Bao (Addgene plasmid # 170826 ; http://n2t.net/addgene:170826 ; RRID:Addgene_170826) -
For your References section:
Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy. Chang Y, Syahirah R, Wang X, Jin G, Torregrosa-Allen S, Elzey BD, Hummel SN, Wang T, Li C, Lian X, Deng Q, Broxmeyer HE, Bao X. Cell Rep. 2022 Jul 19;40(3):111128. doi: 10.1016/j.celrep.2022.111128. 10.1016/j.celrep.2022.111128 PubMed 35858579