pW301-lenti-spsgRNA-hsITGB1-pEF1s-NLS-mNeonGreen-P2A-BlastR
(Plasmid
#170817)
-
PurposeLentiviral vector to co-express a human ITGB1 spsgRNA with NLS-mScarlet-I
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepW211 (Addgene #170809)
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-mNeonGreen-P2A-BlastR
-
gRNA/shRNA sequenceGGACGCCGCGCGGAAAAGGT
-
SpeciesB. lanceolatum; Synthetic; B. coriaceae
-
Insert Size (bp)1221
-
MutationNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
3rd generation lentiviral backbone. Please visit https://www.biorxiv.org/content/10.1101/2020.06.24.165795v2.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pW301-lenti-spsgRNA-hsITGB1-pEF1s-NLS-mNeonGreen-P2A-BlastR was a gift from Kenneth Yamada (Addgene plasmid # 170817 ; http://n2t.net/addgene:170817 ; RRID:Addgene_170817) -
For your References section:
Budding epithelial morphogenesis driven by cell-matrix versus cell-cell adhesion. Wang S, Matsumoto K, Lish SR, Cartagena-Rivera AX, Yamada KM. Cell. 2021 Jul 8;184(14):3702-3716.e30. doi: 10.1016/j.cell.2021.05.015. Epub 2021 Jun 15. 10.1016/j.cell.2021.05.015 PubMed 34133940