Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUASTattB-GFP-Msp300KASH
(Plasmid #170806)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170806 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUASTattB
  • Backbone size w/o insert (bp) 9360
  • Total vector size (bp) 10341
  • Vector type
    Insect Expression
  • Selectable markers
    mini-white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP-Msp300KASH
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    908
  • Promoter 5xUAS + hsp70 minimal promoter
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CAACTGCAACTACTGAAATCTGCC
  • 3′ sequencing primer ggcattccaccactgctccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid derived from GFP-Msp300KASH fusion provided by Janice Fischer and described in:
Yu, J. et al. (2006) The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Developmental biology 289, 336-345, doi:10.1016/j.ydbio.2005.10.027

Plasmid first described in:
Ma, J. and Weake, V.M. (2014). Affinity-based isolation of tagged nuclei from Drosophila tissues for gene expression analysis. Journal of Visualized Experiments 85. PMID:24686501.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUASTattB-GFP-Msp300KASH was a gift from Vikki Weake (Addgene plasmid # 170806 ; http://n2t.net/addgene:170806 ; RRID:Addgene_170806)
  • For your References section:

    In vivo tissue-specific chromatin profiling in Drosophila melanogaster using GFP-tagged nuclei. Jauregui-Lozano J, Bakhle K, Weake VM. Genetics. 2021 May 22. pii: 6281219. doi: 10.1093/genetics/iyab079. 10.1093/genetics/iyab079 PubMed 34022041