pCW57-GFP-2A-Cas9
(Plasmid #170805)

• Purpose: All-in-one doxycycline inducible lentiviral vector for expression of Cas9 in combination with turbo GFP using the P2A self-cleaving peptide
• Depositing Lab: Morten Frodin
• Publication: Niu et al Nat Genet. 2022 Dec 5. doi: 10.1038/s41588-022-01224-7.

Backbone

• Vector backbone: pCW57.1
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9
• Insert Size (bp): 4104
• Tags / Fusion Proteins:
  • NLS (N terminal on backbone)
  • NLS (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pCW57-GFP-2A-Cas9.gb
• A portion of this plasmid was derived from a plasmid made by: Cloned from PX458-3xHA-SpCas9

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry