Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAW240
(Plasmid #170791)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170791 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    ColE1
  • Backbone size w/o insert (bp) 2244
  • Total vector size (bp) 2394
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    p10B2-AT110
  • Species
    Synthetic
  • Promoter 10B2 (P1 specific promoter)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gttggccgattcattaatgcag
  • 3′ sequencing primer AACCTCTGACACATGCAGCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW240 was a gift from Chang Liu (Addgene plasmid # 170791 ; http://n2t.net/addgene:170791 ; RRID:Addgene_170791)
  • For your References section:

    Rapid generation of potent antibodies by autonomous hypermutation in yeast. Wellner A, McMahon C, Gilman MSA, Clements JR, Clark S, Nguyen KM, Ho MH, Hu VJ, Shin JE, Feldman J, Hauser BM, Caradonna TM, Wingler LM, Schmidt AG, Marks DS, Abraham J, Kruse AC, Liu CC. Nat Chem Biol. 2021 Jun 24. pii: 10.1038/s41589-021-00832-4. doi: 10.1038/s41589-021-00832-4. 10.1038/s41589-021-00832-4 PubMed 34168368