Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL1M-pMtRC-MtLAP1-Adh-R1
(Plasmid #170790)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170790 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pL1V-R1-47802
  • Backbone size w/o insert (bp) 4968
  • Vector type
    Bacterial Expression, Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MtLAP1
  • Alt name
    Legume Anthocyanin production 1
  • Species
    Medicago truncatula
  • Insert Size (bp)
    975
  • GenBank ID
    FJ199998
  • Entrez Gene
    LOC11412013 (a.k.a. MTR_8g060940)
  • Promoter Medtr4g059670(MtRC)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site aatgttgtcttcATGATGGAGAATACCGGAGGTGT (destroyed during cloning)
  • 3′ cloning site aagcttgtcttcTCAAGGTAGATCCCAAAGAG (destroyed during cloning)
  • 5′ sequencing primer acccgccaatatatcctgtc
  • 3′ sequencing primer gcaggatatattgtggtgta
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL1M-pMtRC-MtLAP1-Adh-R1 was a gift from Jeremy Murray (Addgene plasmid # 170790 ; http://n2t.net/addgene:170790 ; RRID:Addgene_170790)
  • For your References section:

    A Root Tip-Specific Expressing Anthocyanin Marker for Direct Identification of Transgenic Tissues by the Naked Eye in Symbiotic Studies. Ruan Y, Chen K, Su Y, Jiang S, Xu P, Murray JD. Plants (Basel). 2021 Mar 23;10(3). pii: plants10030605. doi: 10.3390/plants10030605. 10.3390/plants10030605 PubMed 33806858