pE5770
(Plasmid #170777)

• Purpose: expression of hybrid proteins in E. coli
• Depositing Lab: Anthony Schryvers
• Publication: Chaudhuri et al Methods Mol Biol. 2022;2414:115-140. doi: 10.1007/978-1-0716-1900-1_8.

Backbone

• Vector backbone: custom
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 3977
• Total vector size (bp): 5128
• Vector type: Bacterial Expression
• Selectable markers: kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Kan resistance
• Alt name: KanR
• Entrez Gene: kanR (a.k.a. peH4H_0130)
• Promoter: T7
• Tag / Fusion Protein:
  • polyhisbioMbpTEV (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (unknown if destroyed)
• 3′ cloning site: Xba1/HindIII (unknown if destroyed)
• 5′ sequencing primer: GGTCGTCAGACTGTCGATGAAGCC

Resource Information

• Supplemental Documents:
  • E5770.gb
• A portion of this plasmid was derived from a plasmid made by: Not sure. Have been making custom plasmids for over 35 years and cannot readily trace the original sources of all components in the old plasmids.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry