pE5770
(Plasmid
#170777)
-
Purposeexpression of hybrid proteins in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecustom
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 3977
- Total vector size (bp) 5128
-
Vector typeBacterial Expression
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKan resistance
-
Alt nameKanR
-
Entrez GenekanR (a.k.a. peH4H_0130)
- Promoter T7
-
Tag
/ Fusion Protein
- polyhisbioMbpTEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site Xba1/HindIII (unknown if destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNot sure. Have been making custom plasmids for over 35 years and cannot readily trace the original sources of all components in the old plasmids.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pE5770 was a gift from Anthony Schryvers (Addgene plasmid # 170777 ; http://n2t.net/addgene:170777 ; RRID:Addgene_170777) -
For your References section:
Design and Production of Hybrid Antigens for Targeting Integral Outer Membrane Proteins in Gram-Negative Bacteria. Chaudhuri S, Ewasechko NF, Samaniego-Barron L, Fegan JE, Schryvers AB. Methods Mol Biol. 2022;2414:115-140. doi: 10.1007/978-1-0716-1900-1_8. 10.1007/978-1-0716-1900-1_8 PubMed 34784035