pEA01
(Plasmid #170766)

• Purpose: Utilisation of pSAM2 excision tool in Amycolatopsis spp
• Depositing Lab: Jean-Luc Pernodet
• Publication: Santos et al Microorganisms. 2022 Apr 16;10(4). pii: microorganisms10040828. doi: 10.3390/microorganisms10040828.

Backbone

• Vector backbone: pRL60
• Backbone manufacturer: Lal R. et al. 1998. Development of an improved cloning vector and transformation system in Amycolatopsis mediterranei
• Backbone size w/o insert (bp): 10200
• Total vector size (bp): 10632
• Modifications to backbone: deletion of amylase gene
• Vector type: Bacterial Expression
• Selectable markers: Puromycin ; Kanamycin, Erythromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow E. coli strains in presence of Kanamycin at 37°C In Amycolatopsis, pEA01 is unstable in the absence of a selection pressure. Grow the strain at optimal temperature in the presence of one of the three antibiotics: Erythromycin, Kanamycin or Puromycin, depending on the natural resistance of the host strain.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: xis, int
• Alt name: pSAM2 excisionase, pSAM2 integrase
• Species: Streptomyces ambofaciens
• Insert Size (bp): 1356
• GenBank ID: CP012382.1
• Promoter: trcp

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GAGAACGGGTGCGCATAGAA

Gene/Insert 2

• Gene/Insert name: oriT
• Alt name: origin of transfer
• Alt name: incP origin of transfer
• Species: Synthetic; incP origin of transfer from RP4 plasmid
• Insert Size (bp): 110

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GCTGGTGAAGTACATCACCGAC

Gene/Insert 3

• Gene/Insert name: pac
• Alt name: puromycin resistance gene
• Alt name: puromycin N-acetyltransferase
• Species: Streptomyces alboniger
• Insert Size (bp): 600
• GenBank ID: CP023695.1

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: TTGCCACCGCGCTCATCAATC

Resource Information

• Supplemental Documents:
  • pEA01.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry