pJCX4
(Plasmid #170756)

• Purpose: (Empty Backbone) Express in mammalian cells a target protein C-terminally fused to the Mxe GryA intein - chitin binding domain (CBD) tag.
• Depositing Lab: Roberto Dominguez
• Publication: Carman et al J Biol Chem. 2021 Oct;297(4):101154. doi: 10.1016/j.jbc.2021.101154. Epub 2021 Sep 1.

Backbone

• Vector backbone: pJCX4
• Backbone size (bp): 5409
• Modifications to backbone: Derived from pEGFP-C1. The Mxe GyrA intein, chitin binding domain (CBD), and Woodchuck hepatitis virus (WHP) posttranscriptional regulatory element (WPRE) were added to facilitate expression of a target protein in mammalian cells with Mxe GyrA intein - CBD tag fused C-terminally.
• Vector type: Mammalian Expression
• Promoter: CMV
• Tag / Fusion Protein:
  • Mxe GyrA intein - chitin binding domain (CBD) (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CMV for: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: Mxe rev: GATTGCCATGCCGGTCAAGG

Resource Information

• Supplemental Documents:
  • pjcx4.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438513v2 for BioRxiv preprint