pDONR207-MUM2sp-Citrine-ADPG2
(Plasmid
#170725)
-
PurposeGateway (Invitrogen) entry clone (pDONR207) containing the MUM2 (At5g63800) signal peptide (84bp) fused in-frame to the Citrine and the coding sequence of the HG degrading enzyme ADPG2 (At2g41850.1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDONR207
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5585
- Total vector size (bp) 5474
-
Vector typeGateway Donor vector / entry clone
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor selection use 7 ug/ml Gentamicin
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2
-
Alt nameADPG2
-
Alt nameAt2g41850
-
Alt nameQ8RY29 (Uniprot)
-
SpeciesA. thaliana (mustard weed)
-
GenBank IDAC002339
-
Entrez GenePGAZAT (a.k.a. AT2G41850, ADPG2, ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2, T11A7.5, T11A7_5, polygalacturonase abscission zone A. thaliana)
-
Tag
/ Fusion Protein
- Citrine tag (714bp) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site AatII (not destroyed)
- 5′ sequencing primer TAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use with Three-way Multi-site Gateway Cloning (Invitrogen).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR207-MUM2sp-Citrine-ADPG2 was a gift from George Haughn (Addgene plasmid # 170725 ; http://n2t.net/addgene:170725 ; RRID:Addgene_170725) -
For your References section:
Pectin Modification in Seed Coat Mucilage by In Vivo Expression of Rhamnogalacturonan-I- and Homogalacturonan-Degrading Enzymes. McGee R, Dean GH, Wu D, Zhang Y, Mansfield SD, Haughn GW. Plant Cell Physiol. 2021 Jun 1. pii: 6290394. doi: 10.1093/pcp/pcab077. 10.1093/pcp/pcab077 PubMed 34059917