Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDONR207-MUM2sp-PelA
(Plasmid #170722)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170722 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pDONR207
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5585
  • Total vector size (bp) 4551
  • Vector type
    Gateway Donor vector / entry clone

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For selection use 7 ug/ml Gentamicin
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pectin lyase A
  • Alt name
    PelA
  • Alt name
    AN2331.2
  • Alt name
    Q5BAU9 (Uniprot)
  • Species
    Aspergillus nidulans
  • Insert Size (bp)
    1076
  • GenBank ID
    DQ490478

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AatII (not destroyed)
  • 5′ sequencing primer TAACGCTAGCATGGATCTC
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For use with Three-way Multi-site Gateway Cloning (Invitrogen).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR207-MUM2sp-PelA was a gift from George Haughn (Addgene plasmid # 170722 ; http://n2t.net/addgene:170722 ; RRID:Addgene_170722)
  • For your References section:

    Pectin Modification in Seed Coat Mucilage by In Vivo Expression of Rhamnogalacturonan-I- and Homogalacturonan-Degrading Enzymes. McGee R, Dean GH, Wu D, Zhang Y, Mansfield SD, Haughn GW. Plant Cell Physiol. 2021 Jun 1. pii: 6290394. doi: 10.1093/pcp/pcab077. 10.1093/pcp/pcab077 PubMed 34059917