Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBOBI-FLuc
(Plasmid #170674)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170674 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBOBI_cs2.0
  • Backbone manufacturer
    from Han lab
  • Backbone size w/o insert (bp) 8800
  • Total vector size (bp) 10400
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    luc
  • Alt name
    firefly luciferase
  • Species
    firefly
  • Insert Size (bp)
    1600
  • Promoter CMV-F

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatcg
  • 3′ sequencing primer cggtaccaccggttcagtcagtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOBI-FLuc was a gift from David Nemazee (Addgene plasmid # 170674 ; http://n2t.net/addgene:170674 ; RRID:Addgene_170674)
  • For your References section:

    Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model. Rogers TF, Zhao F, Huang D, Beutler N, Burns A, He WT, Limbo O, Smith C, Song G, Woehl J, Yang L, Abbott RK, Callaghan S, Garcia E, Hurtado J, Parren M, Peng L, Ramirez S, Ricketts J, Ricciardi MJ, Rawlings SA, Wu NC, Yuan M, Smith DM, Nemazee D, Teijaro JR, Voss JE, Wilson IA, Andrabi R, Briney B, Landais E, Sok D, Jardine JG, Burton DR. Science. 2020 Aug 21;369(6506):956-963. doi: 10.1126/science.abc7520. Epub 2020 Jun 15. 10.1126/science.abc7520 PubMed 32540903