pLV/Guide-mCherry
(Plasmid #170543)

• Purpose: Expresses mCherry and contains a cassette for U6 driven sgRNA transcription
• Depositing Lab: Jacob Giehm Mikkelsen
• Publication: Thomsen et al Mol Ther Nucleic Acids. 2022 Aug 4;29:563-576. doi: 10.1016/j.omtn.2022.08.005. eCollection 2022 Sep 13.

Backbone

• Vector backbone: pLV_Guide-Puro
• Backbone size w/o insert (bp): 10182
• Total vector size (bp): 10182
• Vector type: Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 713
• Promoter: Ef1-alpha

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAGTTTCCCCACACTGAGT
• 3′ sequencing primer: ACGCCACGTTGCCTGACAAC

Resource Information

• Supplemental Documents:
  • pLV_Guide-mCherry.gbk
• A portion of this plasmid was derived from a plasmid made by: pLV_Guide-Puro was initially cloned based on: lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ; http://n2t.net/addgene:52963 ; RRID:Addgene_52963) and Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene # )

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry