pQlinkH-PTPIP51(36-235)
(Plasmid
#170533)
-
PurposeExpresses Cleavable His-tagged PTPIP51_ΔTPR domain (36-235) in E. Coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQlinkH
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 4901
- Total vector size (bp) 5501
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProtein tyrosine phosphatase interacting protein 51
-
Alt nameRegulator of microtubule dynamics protein 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
Entrez GeneRMDN3 (a.k.a. FAM82A2, FAM82C, RMD-3, RMD3, ptpip51)
- Promoter T5 promoter
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pQTEV3_F, TATAAAAATAGGCGTATCACGAGG
- 3′ sequencing primer pQTEV3_R, CCAGTGATTTTTTTCTCCATTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQlinkH-PTPIP51(36-235) was a gift from Byung Il Lee (Addgene plasmid # 170533 ; http://n2t.net/addgene:170533 ; RRID:Addgene_170533) -
For your References section:
Phospholipid transfer function of PTPIP51 at mitochondria-associated ER membranes. Yeo HK, Park TH, Kim HY, Jang H, Lee J, Hwang GS, Ryu SE, Park SH, Song HK, Ban HS, Yoon HJ, Lee BI. EMBO Rep. 2021 Jun 4;22(6):e51323. doi: 10.15252/embr.202051323. Epub 2021 May 2. 10.15252/embr.202051323 PubMed 33938112