LentiGuide Cherry
(Plasmid
#170510)
-
PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and mCherry marker from EF-1a promoter. 3rd generation lentiviral backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide-Puro
-
Backbone manufacturerFeng Zhang lab (Addgene plasmid #52963)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameS. pyogenes sgRNA cassette
-
Alt nameS. pyogenes CRISPR customizable RNA element
-
SpeciesSynthetic
-
Insert Size (bp)100
- Promoter hU6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)698
- Promoter EF-1a
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer tggttcattctcaagcctcag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCRISPR cassette generated by Feng Zhang
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid based on lentiGuide Puro (addgene plasmid #52963).
Please visit https://www.biorxiv.org/content/10.1101/2021.03.02.433398v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiGuide Cherry was a gift from Pavel Tolar (Addgene plasmid # 170510 ; http://n2t.net/addgene:170510 ; RRID:Addgene_170510) -
For your References section:
Genome-wide screens identify calcium signaling as a key regulator of IgE+ plasma cell differentiation and survival. Newman R, Tolar P. biorXiv 2021.03.02.433398 10.1101/2021.03.02.433398