Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHAGE N-mNeonGreen (from SARS-CoV-2) IRES puro
(Plasmid #170467)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170467 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHAGE
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Nucleocapsid
  • Alt name
    Nucleoprotein
  • Alt name
    SARS-CoV-2 N
  • Species
    SARS-CoV-2
  • GenBank ID
    43740575
  • Promoter EF1
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer TTGAGTTTGGATCTTGGTTC
  • 3′ sequencing primer CATATAGACAAAACGCACACC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE N-mNeonGreen (from SARS-CoV-2) IRES puro was a gift from Raphael Gaudin (Addgene plasmid # 170467 ; http://n2t.net/addgene:170467 ; RRID:Addgene_170467)
  • For your References section:

    Pharmacological perturbation of intracellular dynamics as a SARS-CoV-2 antiviral strategy. Bakhache W, Partiot E, Lucansky V, Bare Y, BonaventurB V, Goujon C, Bories C, Deffieu M.S, Gaudin R. bioRxiv 2021 10.1101/2021.09.10.459410