Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LentiU6-LacZ-GFP-Puro (BB)
(Plasmid #170459)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170459 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    3rd Generation lentiviral vector
  • Backbone size w/o insert (bp) 7466
  • Total vector size (bp) 9882
  • Modifications to backbone
    no
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hU6-BB-LacZ and EF1A-EGFP-2A-Puro
  • Species
    Synthetic
  • Promoter hU6 for gRNA and EF1A for EGFP-2A-Puro

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGGGACAGCAGAGATCCAGTTTGG
  • 3′ sequencing primer TGTTTCAGCAGAGAGAAGTTTGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiU6-LacZ-GFP-Puro (BB) was a gift from Yonglun Luo (Addgene plasmid # 170459 ; http://n2t.net/addgene:170459 ; RRID:Addgene_170459)
  • For your References section:

    Enhancing CRISPR-Cas9 gRNA efficiency prediction by data integration and deep learning. Xiang X, Corsi GI, Anthon C, Qu K, Pan X, Liang X, Han P, Dong Z, Liu L, Zhong J, Ma T, Wang J, Zhang X, Jiang H, Xu F, Liu X, Xu X, Wang J, Yang H, Bolund L, Church GM, Lin L, Gorodkin J, Luo Y. Nat Commun. 2021 May 28;12(1):3238. doi: 10.1038/s41467-021-23576-0. 10.1038/s41467-021-23576-0 PubMed 34050182