LentiU6-LacZ-GFP-Puro (BB)
(Plasmid
#170459)
-
PurposeFor cloning gRNA block
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone3rd Generation lentiviral vector
- Backbone size w/o insert (bp) 7466
- Total vector size (bp) 9882
-
Modifications to backboneno
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin ; EGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6-BB-LacZ and EF1A-EGFP-2A-Puro
-
SpeciesSynthetic
- Promoter hU6 for gRNA and EF1A for EGFP-2A-Puro
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGGGACAGCAGAGATCCAGTTTGG
- 3′ sequencing primer TGTTTCAGCAGAGAGAAGTTTGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiU6-LacZ-GFP-Puro (BB) was a gift from Yonglun Luo (Addgene plasmid # 170459 ; http://n2t.net/addgene:170459 ; RRID:Addgene_170459) -
For your References section:
Enhancing CRISPR-Cas9 gRNA efficiency prediction by data integration and deep learning. Xiang X, Corsi GI, Anthon C, Qu K, Pan X, Liang X, Han P, Dong Z, Liu L, Zhong J, Ma T, Wang J, Zhang X, Jiang H, Xu F, Liu X, Xu X, Wang J, Yang H, Bolund L, Church GM, Lin L, Gorodkin J, Luo Y. Nat Commun. 2021 May 28;12(1):3238. doi: 10.1038/s41467-021-23576-0. 10.1038/s41467-021-23576-0 PubMed 34050182