Skip to main content
Addgene

LentiU6-LacZ-GFP-Puro (BB)
(Plasmid #170459)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170459 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    3rd Generation lentiviral vector
  • Backbone size w/o insert (bp) 7466
  • Total vector size (bp) 9882
  • Modifications to backbone
    no
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin ; EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hU6-BB-LacZ and EF1A-EGFP-2A-Puro
  • Species
    Synthetic
  • Promoter hU6 for gRNA and EF1A for EGFP-2A-Puro

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGGGACAGCAGAGATCCAGTTTGG
  • 3′ sequencing primer TGTTTCAGCAGAGAGAAGTTTGTTG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiU6-LacZ-GFP-Puro (BB) was a gift from Yonglun Luo (Addgene plasmid # 170459 ; http://n2t.net/addgene:170459 ; RRID:Addgene_170459)

  • For your References section:

    Enhancing CRISPR-Cas9 gRNA efficiency prediction by data integration and deep learning. Xiang X, Corsi GI, Anthon C, Qu K, Pan X, Liang X, Han P, Dong Z, Liu L, Zhong J, Ma T, Wang J, Zhang X, Jiang H, Xu F, Liu X, Xu X, Wang J, Yang H, Bolund L, Church GM, Lin L, Gorodkin J, Luo Y. Nat Commun. 2021 May 28;12(1):3238. doi: 10.1038/s41467-021-23576-0. 10.1038/s41467-021-23576-0 PubMed 34050182
Related items:
Commonly requested with: