pSynapsin_NLS_GFP-P2A_SNAP_GluA2
(Plasmid #170455)

• Purpose: Expresses SNAP tagged GluA2 in neuronal cells
• Depositing Lab: Shigeki Watanabe
• Publication: Li et al Nat Commun. 2021 Jan 29;12(1):677. doi: 10.1038/s41467-021-21004-x.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 9300
• Total vector size (bp): 12490
• Modifications to backbone: Ubc promoter replaced with neuron specific synapsin promoter. Introduced NLS-GFP for checking transfection efficiency
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GluA2
• Alt name: AMPA selective glutamate receptor 2
• Species: M. musculus (mouse)
• Insert Size (bp): 2580
• Entrez Gene: Gria2 (a.k.a. GluA2, GluR-B, Glur-2, Glur2, gluR-K2)
• Promoter: Synapsin
• Tags / Fusion Proteins:
  • SNAP (N terminal on insert)
  • SNAP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGGGCATCGACTTCAAGGAGGA

Resource Information

• Supplemental Documents:
  • pSynapsin_NLS_GFP-P2A_SNAP_GluA2.gb
• A portion of this plasmid was derived from a plasmid made by: Christian Rosenmund lab, Berlin, Germany

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry