plenti6-SLC7A11/xCT-V5
(Plasmid #170427)

• Purpose: Eepresses SLC7A11 (also named xCT) in mammalian cells
• Depositing Lab: Boyi Gan
• Publication: Koppula et al J Biol Chem. 2017 Aug 25;292(34):14240-14249. doi: 10.1074/jbc.M117.798405. Epub 2017 Jun 19.

Backbone

• Vector backbone: plenti6.3-V5
• Backbone size w/o insert (bp): 8687
• Total vector size (bp): 10190
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: solute carrier family 7 member 11
• Alt name: Cystine/glutamate transporter
• Species: H. sapiens (human)
• Insert Size (bp): 1503
• GenBank ID: NM_014331
• Entrez Gene: SLC7A11 (a.k.a. CCBR1, xCT)
• Tag / Fusion Protein:
  • V5 (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ATGCAGTGGCAGTGACCTTT
• 3′ sequencing primer: GGCAACAAAGATCGGAACTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry