lenti SYN-SVI-DIO-dCas9-KRAB-MeCP2
(Plasmid #170378)

• Purpose: Expresses a SYN-driven, intron-containing dCas9-KRAB-MeCP2 fusion in which the part of the dCas9 cassette is double floxed and in inverted orientation (DIO). Requires Cre-dependent recombination.
• Depositing Lab: Jeremy Day
• Publication: Carullo et al eNeuro. 2021 Jul 26. pii: ENEURO.0188-21.2021. doi: 10.1523/ENEURO.0188-21.2021.

Backbone

• Vector backbone: lentiCRISPR v2
• Backbone manufacturer: Feng Zhang Addgene plasmid #52961
• Backbone size w/o insert (bp): 7546
• Total vector size (bp): 13818
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: A DIO FLAG-dCas9-KRAB-MeCP2 cassette containing an SV40 intron
• Species: Synthetic
• Insert Size (bp): 5812
• Promoter: human Synapsin promoter
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTATTACAGGGACAGCAGA

Resource Information

• Supplemental Documents:
  • lenti SYN-SVI-DIO-dCas9-KRAB-MeCP2.gb
• A portion of this plasmid was derived from a plasmid made by: dCas9-KRAB-MeCP2 was a gift from Alejandro Chavez & George Church (Addgene plasmid # 110821 ; http://n2t.net/addgene:110821 ; RRID:Addgene_110821)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry