pLEVI(408)-ColE-iLight-msfGFP
(Plasmid #170268)

• Purpose: Expresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.
• Depositing Lab: Vladislav Verkhusha
• Publication: Kaberniuk et al Nat Commun. 2021 Jun 23;12(1):3859. doi: 10.1038/s41467-021-24212-7.

Backbone

• Vector backbone: pLEVI(408)-ColE
• Backbone manufacturer: Y. Yang lab (East China University of Science and Technology, China), https://pubmed.ncbi.nlm.nih.gov/27311594/
• Backbone size w/o insert (bp): 5347
• Total vector size (bp): 7702
• Modifications to backbone: iLight-msfGFP was inserted C-terminally in frame with LexADBD.
• Vector type: Bacterial Expression
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: iLight
• Species: Synthetic; ; Idiomarina sp. A28L
• Insert Size (bp): 2355
• Mutation: To design iLight for expression in bacteria, a full-length bacterial phytochrome IsPadC from Idiomarina sp. A28L was used as an original template. First, diguanylyl cyclase effector in IsPadC was removed, then following mutations were introduced: I68F, H80Q, A86T, R90S S242C, E274K, R295H I360V, and L464V.
• GenBank ID: MW890755
• Promoter: pJ23116
• Tag / Fusion Protein:
  • msfGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: atgaaagcgttaacggccaggcaac
• 3′ sequencing primer: cgtcgccgtccagctcgaccag

Resource Information

• Supplemental Documents:
  • pLEVI(408)-ColE-iLight-msfGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry